After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PCSK9 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PCSK9 cDNA Clone Product Information
Gene_bank_ref_id:NM_153565.2
RefSeq ORF Size:2085bp
cDNA Description:Full length Clone DNA of Mus musculus proprotein convertase subtilisin/kexin type 9 with N terminal HA tag.
Gene Synonym:FH3, Narc1, HCHOLA3, AI415265, AI747682, MGC47409, Pcsk9
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Proprotein convertase subtilisin/kexin type 9 (PCSK9), also known as NARC1 (neural apoptosis regulated convertase), which is a newly identified human secretory subtilase belonging to the proteinase K subfamily of the secretory subtilase family. PCSK9 protein is an enzyme which in humans is encoded by the PCSK9 gene with orthologs found across many species. It is expressed in neuroepithelioma, colon carcinoma, hepatic and pancreatic cell lines, and in Schwann cells. PCSK9 protein is highly expressed in the liver and regulates low density lipoprotein receptor (LDLR) protein levels. Inhibition of PCSK9 protein function is currently being explored as a means of lowering cholesterol levels. Thereby, PCSK9 protein is regarded as a new strategy to treat hypercholesterolemia. PCSK9 protein contributes to cholesterol homeostasis and may have a role in the differentiation of cortical neurons.

References

References
  • Sseidah, N.G. et al., 2003, Proc. Natl. Acad. Sci. USA. 100: 928-933.
  • Beyer, T.P. et al., 2007, J. Lipid. Res. 48: 1488-1498
  • Shan, L. et al., 2008, Biochem. Biophys. Res. Commun. 375: 69-73.
  • Benjannet, S. et al., 2005, J. Biol. Chem. 279: 48865-48875.
  • Abifadel, M. et al., 2003, Nat. Genet. 34: 154-156.
  • Size / Price
    Catalog: MG50251-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"