After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse F11 / FXI ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse F11 cDNA Clone Product Information
Gene_bank_ref_id:NM_028066.1
RefSeq ORF Size:1875bp
cDNA Description:Full length Clone DNA of Mus musculus coagulation factor XI with N terminal HA tag.
Gene Synonym:FXI, Cf11, AI503996, 1600027G01Rik, F11
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Factor XI (plasma thromboplastin antecedent) is a plasma glycoprotein, and a zymogen acting as a serine protease which participates in blood coagulation as a catalyst in the conversion of factor IX to factor IXa in the presence of calcium ions. It is an unusual dimeric protease, with structural features that distinguish it from vitamin K-dependent coagulation proteases. The factor XI is synthesized in the liver as a single polypeptide chain with a molecular weight estimated between 125 ~160 kDa and then is processed into a disulfide-bond linked homodimer. FXI is a homodimer, with each subunit containing four apple domains and a protease domain. The apple domains form a disk structure with binding sites for platelets, high molecular weight kininogen, and the substrate factor IX (FIX). FXI is converted to the active protease FXIa by cleavage of the Arg369-Ile370 bond on each subunit. After the activation reaction, Factor XIa is composed of two heavy and two light chains held together by three disulfide bonds. The heavy chains are derived from the amino termini of the zymogen and responsible for the binding of factor XI to high molecular weight kininogen and for the activation of factor IX, while the light chain contains the catalytic portion of the enzyme and is homologous to the trypsin family of serine proteases. FXI deficiency is a disorder characterized by a mild or no bleeding tendency. Severe FXI deficiency is an injury-related bleeding disorder common in Ashkenazi Jews and rare worldwide.

References
  • Gailani D, et al. (2009) Structural and functional features of factor XI. J Thromb Haemost. 7 Suppl 1: 75-8.
  • Duga S, et al. (2009) Factor XI Deficiency. Semin Thromb Hemost. 35(4): 416-25.
  • Emsley J, et al. (2010) Structure and function of factor XI. Blood. 115(13): 2569-77.
  • Size / Price
    Catalog: MG50237-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"