Quick Order

Mouse CAMKV ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CAMKV cDNA Clone Product Information
Gene_bank_ref_id:NM_145621.2
RefSeq ORF Size:1539bp
cDNA Description:Full length Clone DNA of Mus musculus CaM kinase-like vesicle-associated with N terminal His tag.
Gene Synonym:1G5, BB074618, BC017634
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CaM kinase-like vesicle-associated protein, also known as CAMKV, is a peripheral membrane protein and Cytoplasmic vesicle membrane protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. CAMKV contains one protein kinase domain. It is predominantly observed in association with the plasma membrane of soma and in neurites, both axons and dendrites. CAMKV may be associated with vesicular structures. It does not appear to have detectable kinase activity.

Protein kinases are a group of enzymes that move a phosphate group onto proteins, in a process called phosphorylation. Protein kinases function as an on/off switch for many cellular processes, including metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, apoptosis, and differentiation. They also function in embryonic development, physiological responses, and in the nervous and immune system. Abnormal phosphorylation causes many human diseases, including cancer, and drugs that affect phosphorylation can treat those diseases. The protein kinase domain is a structurally conserved protein domain containing the catalytic function of protein kinases. Protein kinases play a role in a mulititude of cellular processes, including division, proliferation, apoptosis, and differentiation. Phosphorylation usually results in a functional change of the target protein by changing enzyme activity, cellular location, or association with other proteins.

References
  • Hunter T, et al.,1988, Science. 241 (4861): 42-51.
  • Wiemann S., et al., 2001, Genome Res. 11:422-435.
  • G. Manning, et al., 2002, Science 6. 298:1912-1934.
  • Manning G, et al.,2002, Science. 298 (5600): 1912-34.
  • Ota T., et al., 2004, Nat. Genet. 36:40-45.
  • Size / Price
    Catalog: MG52245-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"