Quick Order

Rat FKBP3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat FKBP3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001106736.2
RefSeq ORF Size:675bp
cDNA Description:Full length Clone DNA of Rattus norvegicus FK506 binding protein 3 with C terminal His tag.
Gene Synonym:Fkbp3
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Wiederrecht G., et al., 1992, Biochem. Biophys. Res. Commun. 185: 298 - 303.
  • Dephoure N., et al.,2008, Proc. Natl. Acad. Sci. USA.105:10762-7.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-4501.
  • Choudhary C., et al., 2009, Science. 325:834-840.
  • Size / Price
    Catalog: RG80744-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"