Quick Order

Mouse ELANE / ELA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ELANEcDNA Clone Product Information
cDNA Size:798
cDNA Description:ORF Clone of Mus musculus elastase, neutrophil expressed DNA.
Gene Synonym:NE, F430011M15Rik, Ela2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse ELANE / ELA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

Mouse Neutrophil elastase, also known as Elastase-2, Bone marrow serine protease, Medullasin, ELANE, and ELA2, is a serine proteinase in the same family as chymotrypsin and has broad substrate specificity. Secreted by neutrophils during inflammation, it destroys bacteria and host tissue. As with other serine proteinases, ELANE / ELA2 contains a charge relay system composed of the catalytic triad of histidine, aspartate, and serine residues that are dispersed throughout the primary sequence of the polypeptide but that are brought together in the three dimension conformation of the folded protein. ELANE / ELA2 is an important protease enzyme that when expressed aberrantly can cause emphysema or emphysematous changes. This involves breakdown of the lung structure and increased airspaces. Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. ELANE / ELA2 hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix following the protein's release from activated neutrophils. ELANE / ELA2 may play a role in degenerative and inflammatory diseases by its proteolysis of collagen-IV and elastin of the extracellular matrix. ELANE / ELA2 degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Defects in ELANE are a cause of cyclic haematopoiesis (CH), also known as cyclic neutropenia. CH is an autosomal dominant disease in which blood-cell production from the bone marrow oscillates with 21-day periodicity. Defects in ELANE are also the cause of autosomal dominant severe congenital neutropenia type 1 (SCN1) which is a heterogeneous disorder of hematopoiesis.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items