Quick Order

Text Size:AAA

Mouse C1QBP Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
C1QBPcDNA Clone Product Information
Gene_bank_ref_id:NM_007573.2
cDNA Size:840
cDNA Description:ORF Clone of Mus musculus complement component 1, q subcomponent binding protein DNA.
Gene Synonym:P32, HABP1, gC1qBP, AA407365, AA986492, D11Wsu182e, C1qbp
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Hyaluronan binding protein 1 (HABP1), also known as p32 or gC1qR, is a ubiquitously expressed multifunctional phospho-protein implicated in cell signalling. Hyaluronan-binding protein 1 (HABP1) /p32/gC1qR was characterized as a highly acidic and oligomeric protein, which binds to different ligands like hyaluronan, C1q, and mannosylated albumin. The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro. HABP1 overexpressing cells showed extensive vacuolation and reduced growth rate, which was corrected by frequent medium replenishment. Further investigation revealed that HABP1 overexpressing cells undergo apoptosis, and they failed to enter into the S-phase. The sperm surface HABP1 level can be correlated with the degree of sperm motility.Hyaluronan binding protein 1 (HABP1) was reported to be present on human sperm surface and its involvement in fertilization has already been elucidated: decreased HABP1 level may be associated with low motility of sperms, which in turn might cause infertility in the patient. HABP1 also is an endogenous substrate for MAP kinase and upon mitogenic stimulation it is translocated to the nucleus in a MAP kinase-dependent manner.

References
  • Meenakshi J, et al. (2003) Constitutive expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR) in normal fibroblast cells perturbs its growth characteristics and induces apoptosis. Biochemicaland Biophysical Research Communication. 300(3): 686-93.
  • Majumdar M, et al. (2002) Hyaluronan Binding Protein 1 (HABP1) /C1QBP/p32 Is an Endogenous Substrate for MAP Kinase and Is Translocated to the Nucleus upon Mitogenic Stimulation. Biochemical and Biophysical Research Communications. 291(4): 829-37.
  • Ghosh I, et al. (2002) Reduction in the level of hyaluronan binding protein 1 (HABP1) is associated with loss of sperm motility. Journal of Reproductive Immunology. 53(1-2): 45-54.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"