Quick Order

Text Size:AAA

Rat CCL6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL6cDNA Clone Product Information
cDNA Size:348
cDNA Description:ORF Clone of Rattus norvegicus chemokine (C-C motif) ligand 6 DNA.
Gene Synonym:Mrp-1, Scay6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Chemokine & Receptor Related Products
Product nameProduct name

Chemokine (C-C motif) ligand 6 (CCL6), also known as C-C chemokine C10 has only been identified in rodents, which is a small cytokine belonging to the CC chemokine family, beta-chemokine subfamily. C-C chemokine C10 is involved in the chronic stages of host defense reactions. C10 chemokine rapidly promotes disease resolution in the cecal ligation and puncture (CLP) model through its direct effects on the cellular events critically involved in host defense during septic peritonitis. CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. C10 is a prominent chemokine expressed in the central nervous system in experimental inflammatory demyelinating disease, also acts as a potent chemotactic factor for the migration of these leukocytes to the brain. CCL6 may be a mediator released by microglia for cell-cell communication under physiological as well as pathological conditions of CNS. Additionally, the chemokine CCL6 may alter tumor behavior by relieving its growth factor dependency and by promoting invasiveness as a result of local tissue apoptosis.

  • Asensio VC, et al. (1999) C10 is a novel chemokine expressed in experimental inflammatory demyelinating disorders that promotes recruitment of macrophages to the central nervous system. Am J Pathol. 154(4): 1181-91.
  • Steinhauser ML, et al. (2000) Chemokine C10 promotes disease resolution and survival in an experimental model of bacterial sepsis. Infect Immun. 68(11): 6108-14.
  • Yi F, et al. (2003) The CCL6 chemokine is differentially regulated by c-Myc and L-Myc, and promotes tumorigenesis and metastasis. Cancer Res. 63(11): 2923-32.
  • LaFleur AM, et al. (2004) Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis. Mediators Inflamm. 13(5-6): 349-55.
  • Kanno M, et al. (2005) Functional expression of CCL6 by rat microglia: a possible role of CCL6 in cell-cell communication. J Neuroimmunol. 167(1-2): 72-80.

    CCL6/C10 related areas, pathways, and other information

    Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks