After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat COQ7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
COQ7cDNA Clone Product Information
cDNA Size:654
cDNA Description:ORF Clone of Rattus norvegicus coenzyme Q7 homolog, ubiquinone (yeast) DNA.
Gene Synonym:Coq7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Ubiquinone biosynthesis protein COQ7 homolog, also known as Coenzyme Q biosynthesis protein 7 homolog, Timing protein clk-1 homolog and COQ7, is a mitochondrion inner membrane and peripheral membrane protein which belongs to the COQ7 family. It is expressed dominantly in heart and skeletal muscle. COQ7 is synthesized as a preprotein that is imported into the mitochondrial matrix, where the sequence is cleaved off and the mature protein becomes loosely associated with the inner membrane. This enzyme is responsible for the hydroxylation of 5-demethoxyubiquinone to 5-hydroxyubiquinone. Human COQ7 protein is mostly helical, and contains an alpha-helical membrane insertion. It has a potential N-glycosylation site, a phosphorylation site for protein kinase C and another for casein kinase II, and three N-myristoylation sites. COQ7 is involved in lifespan determination in ubiquinone-independent manner. It is also involved in ubiquinone biosynthesis. COQ7 is potential central metabolic regulator.

  • Ewbank J.J., et al., 1997, Science. 275: 980-3.
  • Vajo Z., et al., 1999, Mamm. Genome. 10: 1000-4.
  • Wiemann S., et al., 2001, Genome Res. 11: 422-35.
  • Stenmark,P. et al., 2001, J Biol Chem. 276 (36): 33297-300.
  • Martin J., et al., 2004, Nature. 432: 988-94. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items