After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse HMGN3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HMGN3cDNA Clone Product Information
cDNA Size:288
cDNA Description:ORF Clone of Mus musculus high mobility group nucleosomal binding domain 3 DNA.
Gene Synonym:TRIP7, BB071015, 1110002A15Rik, 6330514M13Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

HMGN3 belongs to the HMGN family and is expressed in kidney, lung, pancreas, testis, skeletal muscle, heart, thyroid gland, pituitary gland, prostate and uterus. Members of the HMGN family bind to nucleosomes without any specificity for the underlying DNA sequence. They affect the global and local structure of chromatin, as well as the levels of histone modifications and thus play a role in epigenetic regulation of gene expression. HMGN3 regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. It also regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. Both insulin and glucagon levels can be affected by HMGN3. HMGN3 may play a role in ocular development and astrocyte function. It also modulates the expression of pancreatic genes involved in insulin secretion.

  • Ueda T, et al. (2009) The nucleosome binding protein HMGN3 modulates the transcription profile of pancreatic beta cells and affects insulin secretion. Mol Cell Biol. 29(19):5264-76.
  • Lei SF, et al. (2012) Genome-wide association study identifies HMGN3 locus for spine bone size variation in Chinese. Hum Genet. 131(3):463-9.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.