Quick Order

Text Size:AAA

Mouse CCL8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL8cDNA Clone Product Information
cDNA Size:294
cDNA Description:ORF Clone of Mus musculus chemokine (C-C motif) ligand 8 DNA.
Gene Synonym:HC14, Mcp2, MCP-2, Scya8, AB023418, 1810063B20Rik, Ccl8
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 8 (CCL8), also known as monocyte chemoattractant protein 2 (MCP-2), is a small cytokine belonging to the C-C chemokine family. CCL8 functions to activate different immune cells, including mast cells, eosinophils and basophils which are involved in allergic responses, monocytes, and T cells and NK cells which are involved in the inflammatory response. CCL8's ability achieves by binding to different cell surface receptors termed chemokine receptors including CCR1, CCR2B and CCR5. It has been reported that CCL8 is a potent inhibitor of HIV-1 by virtue of its binding to CCR5 which is one of the major co-receptors for HIV-1.

  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28 (5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811–5.
  • Hori T, et al. (2008) CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 111 (8): 4403-12.
  • Biber K, et al. (2003) Expression of L-CCR in HEK 293 cells reveals functional responses to CCL2, CCL5, CCL7, and CCL8. Journal of Leukocyte Biology. 74 (2): 243-51.

    CCL8/MCP-2 related areas, pathways, and other information

    Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks