Quick Order

Text Size:AAA

Mouse WTAP ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse WTAP cDNA Clone Product Information
Gene_bank_ref_id:NM_175394.2
RefSeq ORF Size:456bp
cDNA Description:Full length Clone DNA of Mus musculus Wilms tumour 1-associating protein with N terminal His tag.
Gene Synonym:2810408K05Rik, 9430038B09Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

References
  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • Size / Price
    Catalog: MG52198-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"