After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse CXCL9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL9cDNA Clone Product Information
cDNA Size:381
cDNA Description:ORF Clone of Mus musculus chemokine (C-X-C motif) ligand 9 DNA.
Gene Synonym:CMK, Mig, Scyb9, crg-10, BB139920, Cxcl9
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name

Chemokine (C-X-C motif) ligand 9 (CXCL9), also known as Monokine induced by gamma interferon (MIG), is a small cytokine belonging to the CXC chemokine family. The function of this chemokine has not been specifically defined; however, it is thought to be involved in T cell trafficking. CXCL9/MIG functions as one of the three ligands of chemokine receptor CXCR3 which is a G protein-coupled receptor found predominantly on T cells. CXCL9/MIG, together with CXCL10 and CXCL11, may activate CXCR3 by binding to it. CXCL9 serves as a cytokine that affects the growth, movement, or activation state of cells that participate in immune and inflammatory response. It has been observed that tumour endothelial cells secrete high levels of CXCL9 in all, and CXCL10 in most melanoma metastases. Experiment data represent novel mechanisms by which tumour cells in melanoma metastases might use the chemokine-expressing endothelium to leave the tumour and eventually to form additional metastases at distinct sites. Experiment results also improved that CXCL9/MIG plays an important role in CD4+ T lymphocyte recruitment and development of CAV, MOMA-2+ macrophages are the predominant recipient-derived source of CXCL9/MIG, and recipient CD4 lymphocytes are necessary for sustained CXCL9/MIG production and CAV development in this model. Neutralization of the chemokine CXCL9/MIG may have therapeutic potential for the treatment of chronic rejection after heart transplantation.

  • Ruehlmann JM, et al. (2001) MIG (CXCL9) chemokine gene therapy combines with antibody-cytokine fusion protein to suppress growth and dissemination of murine colon carcinoma. Cancer Res. 61(23): 8498-503.
  • Belperio JA, et al. (2003) Role of CXCL9/CXCR3 chemokine biology during pathogenesis of acute lung allograft rejection. J Immunol. 171(9): 4844-52.
  • Colvin RA, et al. (2004) Intracellular domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem. 279(29): 30219-27.
  • Valbuena G, et al. (2003) Expression analysis of the T-cell-targeting chemokines CXCL9 and CXCL10 in mice and humans with endothelial infections caused by rickettsiae of the spotted fever group. Am J Pathol. 163(4): 1357-69.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items