Quick Order

Text Size:AAA

Mouse CMBL ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CMBL cDNA Clone Product Information
Gene_bank_ref_id:NM_181588.3
RefSeq ORF Size:738bp
cDNA Description:Full length Clone DNA of Mus musculus carboxymethylenebutenolidase-like (Pseudomonas) with C terminal HA tag.
Gene Synonym:2310016A09Rik
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Carboxymethylenebutenolidase (CMBL), also known as 4-carboxymethylenebut-2-en-4-olide lactonohydrolase, maleylacetate enol- lactonase, dienelactone hydrolase, and carboxymethylene butenolide hydrolase, is a hydrolase specially belonging to the family of hydrolases. It maily acts on carboxylic ester bonds. CMBL is a human homolog of Pseudomonas dienelactone hydrolase involved in the bacterial halocatechol degradation pathway. The ubiquitous expression of human CMBL gene transcript in various tissues was observed. CMBL was demonstrated to be the primary olmesartan medoxomil (OM) bioactivating enzyme in the liver and intestine. The recombinant human CMBL expressed in mammalian cells was clearly shown to activate OM. The recombinant CMBL also converted other prodrugs having the same ester structure as OM, faropenem medoxomil and lenampicillin, to their active metabolites. CMBL exhibited a unique sensitivity to chemical inhibitors, thus, being distinguishable from other known esterases.  

References
  • Ishizuka T, et al. (2010) Human Carboxymethylenebutenolidase as a Bioactivating Hydrolase of Olmesartan Medoxomil in Liver and Intestine. The Journal of Biological Chemistry. 285: 11892-902.
  • Schmidt E, et al. (1980) Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid. Biochem J. 192 (1): 339-47.
  • Size / Price
    Catalog: MG51405-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"