After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse Thrombopoietin / THPO Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
THPOcDNA Clone Product Information
Gene_bank_ref_id:NM_009379.3
cDNA Size:1071
cDNA Description:ORF Clone of Mus musculus Thrombopoietin DNA.
Gene Synonym:TPO, Mpllg, TPO-1, TPO-2, TPO-3, TPO-4
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse Thrombopoietin / THPO Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name
Background

Thrombopoietin (TPO or THPO), also known as myeloproliferative leukemia virus ligand (c-Mpl), is a hematopoietic growth factor belonging to the EPO/TPO family. The thrombopoietin protein is produced mainly by the liver and the kidney that regulates the production of platelets by the bone marrow. Thrombopoietin protein stimulates both proliferation of progenitor megakaryocytes and their maturation to platelet-producing megakaryocytes, and also accelerates the recovery of platelets. Thrombopoietin protein is involved in cardiovascular disease as it regulates megakaryocyte development and enhances platelet adhesion/aggregation. It has been identified that surface c-MPL, the receptor for thrombopoietin protein, binds to the ligand and mediates the action.

References
  • Ryu T,et al.(2003) Thrombopoietin-producing hepatocellular carcinoma. Intern Med. 42(8): 730-4.
  • Higashihara M,et al. (2003) Thrombopoietin-producing tumor. Intern Med. 42(8): 632-3?
  • Size / Price
    Catalog:MG50146-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"