Quick Order

Mouse ECSIT ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ECSIT cDNA Clone Product Information
Gene_bank_ref_id:NM_001253897.1
RefSeq ORF Size:1308bp
cDNA Description:Full length Clone DNA of Mus musculus ECSIT homolog (Drosophila) with N terminal His tag.
Gene Synonym:Sitpec
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ECSIT is an adapter protein of the toll-like and IL-1 receptor signaling pathway that is involved in the activation of NF-kappa-B via MAP3K1. Activation of NF-kappaB as a consequence of signaling through the Toll and IL-1 receptors is a major element of innate immune responses. ECSIT is specific for the Toll/IL-1 pathways and is a regulator of MEKK-1 processing. It bridges TRAF6 to MEKK-1. Expression of wild-type ECSIT accelerates processing of MEKK-1, whereas a dominant-negative fragment of ECSIT blocks MEKK-1 processing and activation of NF-kappaB. ECSIT is also required for normal embryonic development and efficient assembly of mitochondrial NADH:ubiquinone oxidoreductase.

References
  • Kopp E. et al., 1999, Genes Dev. 13 (16): 2059-71.
  • The MGC Project Team. 2004, Genome Res. 14: 2121-7.
  • Vogel RO. et al., 2007, Genes Dev. 21: 615-24.
  • Size / Price
    Catalog: MG52140-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"