After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse B7-2 / CD86 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
CD86cDNA Clone Product Information
Gene Bank Ref.ID:AF065897.1
cDNA Size:930
cDNA Description:ORF Clone of Mus musculus CD86 antigen DNA.
Gene Synonym:B7, B70, MB7, B7-2, B7.2, CLS1, Ly58, ETC-1, Ly-58, MB7-2, Cd28l2, TS/A-2, Cd86
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell surface immunoglobulin superfamily. B7-2 exists predominantly as a monomer on cell surfaces and interacts with two co-stimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus induces the signal pathways which regulate T cell activation and tolerance, cytokine production, and the generation of CTL. It is indicated that contacts between B and T helper cells mediated by CD86 encourage signals for the proliferation and IgG secretion of normal B cells and B cell lymphomas. Recent study has revealed that CD86 also promotes the generation of a mature APC repertoire and promotes APC function and survival. CD86 has an important role in chronic hemodialysis, allergic pulmonary inflammation, arthritis, and antiviral responses, and thus is regarded as a promising candidate for immune therapy.

Reference
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • Rau FC, et al. (2009) B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. J Immunol. 183(12): 7661-71.
  • Dai ZS, et al. (2009) Defective expression and modulation of B7-2/CD86 on B cells in B cell chronic lymphocytic leukemia. Int J Hematol. 89(5): 656-63.
  • Size / Price
    Catalog:MG50068-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"