Quick Order

Rat CASP14 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CASP14 cDNA Clone Product Information
Gene_bank_ref_id:NM_001191776.1
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Rattus norvegicus caspase 14 with C terminal His tag.
Gene Synonym:caspase-14
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of a prodomain plus large and small catalytic subunits, that play a central role in cell apoptosis. Caspase 14 possesses an unusually short prodomain and is highly expressed in embryonic tissues but absent from most of the adult tissues except for the skin, which suggests a role in ontogenesis and skin physiology. Unlike the other short prodomain caspases(caspase-3, caspase-6, and caspase-7), Caspase 14 was not processed by multiple death stimuli including activation of members of the tumor necrosis factor receptor family and expression of proapaptotic members of the bcl-2 family. Caspase 14 has been described to be processed and activated by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may take part in keratinocyte terminal differentiation, which is essential for the skin barrier.

References
  • Hu SM, et al. (1998) Caspase-14 is a novel developmentally regulated protease. The journal of biological chemistry. 273: 29648-53.
  • Marc Van De Craen, et al. (1998) Identification of a new caspase homologue: caspase-14. Cell death differ. 5(10): 838-46.
  • Size / Price
    Catalog: RG80602-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"