After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse LYVE-1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LYVE1 cDNA Clone Product Information
Gene_bank_ref_id:NM_053247.4
RefSeq ORF Size:957bp
cDNA Description:Full length Clone DNA of Mus musculus lymphatic vessel endothelial hyaluronan receptor 1 with C terminal HA tag.
Gene Synonym:Xlkd1, Lyve-1, Crsbp-1, 1200012G08Rik, Lyve1
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

LYVE1, also known as LYVE-1, is a type I integral membrane glycoprotein. It contains 1 Link domain and mainly expressed in endothelial cells lining lymphatic vessels. LYVE1 acts as a receptor and binds to both soluble and immobilized hyaluronan. It may function in lymphatic hyaluronan transport and have a role in tumor metastasis. LYVE1 also is a cell surface receptor on lymphatic endothelial cells that can be used as a lymphatic endothelial cell marker, and sort these cells for experimental purposes. It also functions as a ligand-specific transporter trafficking between intracellular organelles and the plasma membrane. It plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding. It may act as an hyaluronan transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.

References
  • Jackson DG. (2003) The lymphatics revisited: new perspectives from the hyaluronan receptor LYVE-1. Trends Cardiovasc Med. 13(1):1-7.
  • Banerji S, et al. (1999) LYVE-1, a new homologue of the CD44 glycoprotein, is a lymph-specific receptor for hyaluronan. J Cell Biol. 144(4):789-801.
  • Mouta Carreira C, et al. (2001) LYVE-1 is not restricted to the lymph vessels: expression in normal liver blood sinusoids and down-regulation in human liver cancer and cirrhosis. Cancer Res. 61(22): 8079-84.
  • Cursiefen C, et al. (2002) Lymphatic vessels in vascularized human corneas: immunohistochemical investigation using LYVE-1 and podoplanin. Invest Ophthalmol Vis Sci. 43(7):2127-35.
  • Size / Price
    Catalog: MG50065-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"