After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat AK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AK1cDNA Clone Product Information
cDNA Size:585
cDNA Description:ORF Clone of Rattus norvegicus adenylate kinase 1 DNA.
Gene Synonym:Ak1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Lu Q, et al. (1996) Adenylate kinase complements nucleoside diphosphate kinase deficiency in nucleotide metabolism. Proc Natl Acad Sci. 93 (12): 5720-5.
  • Dzeja P, et al. (2009) Adenylate kinase and AMP signaling networks: Metabolic monitoring, signal communication and body energy sensing. Int J Mol Sci. 10 (4): 1729-72.
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106 - 11.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items