After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDK4cDNA Clone Product Information
Gene_bank_ref_id:NM_053593.2
cDNA Size:912
cDNA Description:ORF Clone of Rattus norvegicus cyclin-dependent kinase 4 DNA.
Gene Synonym:Cdk4
Species:Rat
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

CDK4 is a member of the Ser/Thr protein kinase family. It is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of CDK4 is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). CDK4 was shown to be responsible for the phosphorylation of retinoblastoma gene product. CDK4 is the ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. CDK4 has been shown to be mutated in some types of cancer, whilst a chromosomal rearrangement can lead to Cdk6 overexpression in lymphoma, leukemia and melanoma.

References
  • Stepanova L, et al. (1996) Mammalian p50Cdc37 is a protein kinase-targeting subunit of Hsp90 that binds and stabilizes Cdk4. Genes Dev. 10(12):1491-502.
  • Lamphere L, et al. (1997) Interaction between Cdc37 and Cdk4 in human cells. Oncogene. 14(16): 1999-2004.
  • Dai K, et al. (1996) Physical interaction of mammalian CDC37 with CDK4. J Biol Chem. 271(36): 22030-4.
  • Sugimoto M, et al. (1999) Regulation of CDK4 activity by a novel CDK4-binding protein, p34SEI-1. Genes Dev. 13(22):3027-33.
  • Size / Price
    Catalog:RG80553-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"