Quick Order

Mouse CAXII Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
CA12cDNA Clone Product Information
Gene Bank Ref.ID:NM_178396.3
cDNA Size:1065
cDNA Description:ORF Clone of Mus musculus carbonic anyhydrase 12 DNA.
Gene Synonym:AI314958, 2310047E01Rik
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA12, also known as Car12 and carbonic anhydrase XII, is a type I  membrane enzyme of an N-terminal extracellular catalytic domain, a membrane-spanning α-helix, and a small intracellular C-terminal domain. It is highly expressed in colon, kidney, prostate, intestine and activated lymphocytes and moderately expressed in pancreas, ovary, and testis. Overexpression of the CA12 is observed in certain human cancers and is used as a tumor marker. rmCA12 corresponds to the extracellular domain and has both carbonic anhydrase activity and esterase activity.

Reference
  • Sahin, U. et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 92 (25): 11810–11813.
  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596 - 12601.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 16903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Size / Price
    Catalog:MG50014-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"