Quick Order

Text Size:AAA

Rat SUMO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SUMO1cDNA Clone Product Information
cDNA Size:306
cDNA Description:ORF Clone of Rattus norvegicus SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) DNA.
Gene Synonym:Sumo1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.