Quick Order

Text Size:AAA

Mouse BACE1 / ASP2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BACE1cDNA Clone Product Information
cDNA Size:1506
cDNA Description:ORF Clone of Mus musculus beta-site APP-cleaving enzyme 1 DNA.
Gene Synonym:C76936
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in peripheral nerve cells. In the brain, This protein is expressed highly in the substantia nigra, locus coruleus and medulla oblongata. Strong BACE1 expression has also been described in pancreatic tissue. BACE1 has a pivotal role in the pathogenesis of Alzheimer's disease. In Alzheimer's disease patients, BACE1 levels were elevated although mRNA levels were not changed. It has been found that BACE1 gene expression is controlled by a TATA-less promoter. The translational repression as a new mechanism controlling its expression. And the low concentrations of Ca(2+) (microM range) significantly increased the proteolytic activity of BACE1. Furthermore, BACE1 protein is ubiquitinated, and the degradation of BACE1 proteins and amyloid precursor protein processing are regulated by the ubiquitin-proteasome pathway. It has also been identified as the rate limiting enzyme for amyloid-beta-peptide (Abeta) production.

  • Christensen MA, et al. (2004) Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol Cell Biol. 24(2):865-74.
  • Stockley JH, et al. (2007) The proteins BACE1 and BACE2 and beta-secretase activity in normal and Alzheimer's disease brain. Biochem Soc Trans. 35(Pt 3): 574-6.
  • Savonenko AV, et al. (2008) Alteration of BACE1-dependent NRG1/ErbB4 signaling and schizophrenia-like phenotypes in BACE1-null mice. Proc Natl Acad Sci U S A. 105(14): 5585-90.
  • Hayley M, et al. (2009) Calcium enhances the proteolytic activity of BACE1: An in vitro biophysical and biochemical characterization of the BACE1-calcium interaction. Biochim Biophys Acta. 1788(9): 1933-8.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items