Quick Order

Rat SERPINE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINE1cDNA Clone Product Information
cDNA Size:1209
cDNA Description:ORF Clone of Rattus norvegicus serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 DNA.
Gene Synonym:Pai1, PAI1A, Planh, Pai1aa, RATPAI1A
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Plasminogen activator inhibitor 1, also known as PAI-1, Endothelial plasminogen activator inhibitor, SerpinE1 and PLANH1, is a secreted glycoprotein which belongs to the serpin family. SerpinE1 is the primary physiological inhibitor of the two plasminogen activators urokinase (uPA) and tissue plasminogen activator (tPA). Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Defects in SerpinE1 are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency) which is characterized by abnormal bleeding due to SerpinE1 defect in the plasma. High concentrations of SerpinE1 have been associated with thrombophilia which is an autosomal dominant disorder in which affected individuals are prone to develop serious spontaneous thrombosis. Studies of PAI-1 have contributed significantly to the elucidation of the protease inhibitory mechanism of serpins, which is based on a metastable native state becoming stabilised by insertion of the RCL into the central beta-sheet A and formation of covalent complexes with target proteases. Greater expression of PAI-1 has been associated with increased survival of cells and resistance to apoptosis. PAI-1 appears to influence apoptosis by decreasing cell adhesion (anoikis) as well as its effect on intracellular signaling. PAI-1, in its active state, also binds to the extracellular protein vitronectin. When in complex with its target proteases, it binds with high affinity to endocytosis receptors of the low density receptor family. The mechanisms of PAI-1 overexpression during obesity are complex, and it is conceivable that several inducers are involved at the same time at several sites of synthesis. PAI-1 is also implicated in adipose tissue development. It suggests that PAI-1 inhibitors serve in the control of atherothrombosis.

  • Alessi MC, et al. (2006) PAI-1 and the metabolic syndrome: links, causes, and consequences. Arterioscler Thromb Vasc Biol. 26(10): 2200-7.
  • Schneider DJ, et al. (2008) The effect of plasminogen activator inhibitor type 1 on apoptosis. Thromb Haemost. 100(6): 1037-40.
  • Dupont DM, et al. (2009) Biochemical properties of plasminogen activator inhibitor-1. Front Biosci. 14: 1337-61.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items