Quick Order

Rat CD302 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD302cDNA Clone Product Information
Gene_bank_ref_id:NM_001013916.1
cDNA Size:687
cDNA Description:ORF Clone of Rattus norvegicus CD302 molecule DNA.
Gene Synonym:MGC108799, RGD1307606, Cd302
Species:Rat
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

CD302/CLEC13A (C-type lectin domain family 13 member A), also known as C-type lectin receptor DCL-1, is a type I transmembrane C-type lectin DCL-1/CD302. DCL-1 protein was highly conserved among the human, mouse, and rat orthologs. DCL-1 ectodomain contains only one CRD, whereas other type I transmembrane C-type lectins contain more than one domain (e.g. selectins and MMR). DCL-1 CP contains several putative motifs, including a Tyr-based internalization, a cluster of acidic amino acids, and Ser and Tyr phosphorylation motifs, suggesting that DCL-1 CP mediates not only endocytosis and late endosome targeting but also signaling. DCL-1 may be another cell/matrix adhesion receptor integrated in cell adhesion complexes and that DCL-1 dysfunction may affect APC adhesion and migration, causing suppression of APC function.

References
  • Kato M, et al. (2007) The novel endocytic and phagocytic C-Type lectin receptor DCL-1/CD302 on macrophages is colocalized with F-actin, suggesting a role in cell adhesion and migration. J Immunol. 179(9): 6052-63.
  • Skinnider BF, et al. (2002) The role of cytokines in classical Hodgkin lymphoma. Blood. 99(12): 4283-97.
  • Size / Price
    Catalog:RG80414-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"