After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD300A ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD300A cDNA Clone Product Information
Gene_bank_ref_id:NM_001205348.1
RefSeq ORF Size:933bp
cDNA Description:Full length Clone DNA of Rattus norvegicus CD300A molecule with C terminal His tag.
Gene Synonym:CLM-8, Cd300a
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Mouse CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor protein 60, NK inhibitory receptor, CD300a and CMRF35H, is a single-pass type I membrane protein which belongs to the CD300 family. The CD300 family of myeloid immunoglobulin receptors includes activating ( CD300b, CD300e ) and inhibitory members ( CD300a, CD300f ), as well as molecules presenting a negative charge within their transmembrane domain ( CD300c, CD300d ).  CD300A / IGSF12 is expressed not only by natural killer (NK) cells but also by T-cell subsets, B-cells, dendritic cells, mast cells, granulocytes and monocytes.It contains one Ig-like V-type ( immunoglobulin-like ) domain. CD300A / IGSF12 is an inhibitory receptor which may contribute to the down-regulation of cytolytic activity in natural killer (NK) cells, and to the down-regulation of mast cell degranulation. CD300c is a functional immune receptor able to deliver activating signals upon ligation in RBL-2H3 mast cells. CD300c signaling is partially mediated by a direct association with the immune receptor tyrosine-based activation motif-bearing adaptor FcεRγ. CD300a and CD300c play an important role in the cross-regulation of TNF-alpha and IFN-alpha secretion from plasmacytoid dendritic cells (pDCs).

References
  • Bachelet,I. et al., 2005, J. Immunol. 175:7989-7995.
  • Bachelet,I. et al., 2008, J Immunol. 180 (9):6064-9.
  • Ju,X. et al., 2008, Blood. 112 (4):1184-94.
  • Martínez-Barriocanal,A. et al., 2010, J Biol Chem. 285 (53):41781-94.
  • Lankry,D. et al., 2010, J Immunol. 185 (5):2877-86.
  • Size / Price
    Catalog: RG80410-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"