After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FTL Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FTLcDNA Clone Product Information
Gene_bank_ref_id:NM_000146.3
cDNA Size:528
cDNA Description:ORF Clone of Homo sapiens ferritin, light polypeptide DNA.
Gene Synonym:LFTD; NBIA3
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

References
  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"