After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat COLEC12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
COLEC12cDNA Clone Product Information
cDNA Size:2229
cDNA Description:ORF Clone of Rattus norvegicus collectin sub-family member 12 DNA.
Gene Synonym:MGC114569, Colec12
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CLP1, also known as COLEC12, is a scavenger receptor that displays several functions associated with host defense. It contains 1 C-type lectin domain and 3 collagen-like domains. CLP1 is strongly expressed in placenta and moderately expressed in heart, skeletal muscle, small intestine and lung. It promotes binding and phagocytosis of Gram-positive, Gram-negative bacteria and yeast. CLP1 mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. It binds to several carbohydrates including Gal-type ligands, D-galactose, L- and D-fucose, GalNAc, T and Tn antigens in a calcium-dependent manner and internalizes specifically GalNAc in nurse-like cells. It binds also to sialyl Lewis X or a trisaccharide and asialo-orosomucoid (ASOR). CLP1 may also play a role in the clearance of amyloid beta in Alzheimer disease.

  • Ramirez A, et al. (2008) Human RNA 5'-kinase (hClp1) can function as a tRNA splicing enzyme in vivo. RNA. 14(9):1737-45.
  • Danielsen JM, et al.. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.

    Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks