Quick Order

Rat ADAM17 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat ADAM17 cDNA Clone Product Information
Gene_bank_ref_id:NM_020306.1
RefSeq ORF Size:2484bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ADAM metallopeptidase domain 17 with C terminal His tag.
Gene Synonym:TACE, Adam17
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ADAM17 is a member of the ADAM protein family of disintegrins and metalloproteases. ADAM17 is ubiquitously expressed in the human colon, with increased activity in the colonic mucosa of patients with ulcerative colitis, a main form of inflammatory bowel disease. The expression of ADAM17 may be inhibited by ethanol. It is involved in the processing of tumor necrosis factor alpha (TNF-α) at the surface of the cell, and from within the intracellular membranes of the trans-Golgi network. ADAM17 also plays a role in the release of a diverse variety of membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes. ADAM17 may play a prominent role in the Notch signaling pathway, during the proteolytic release of the Notch intracellular domain (from the Notch1 receptor) that occurs following ligand binding.

References
  • Poghosyan. et al., 2002, J Biol Chem. 277 (7): 4999-5007.
  • Li Y. et al., 2006, Blood. 108 (7): 2275-9.
  • Peiretti. et al., 2003, J Cell Sci. 116 (10): 1949-57.
  • Size / Price
    Catalog: RG80350-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"