After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse HSP90AA1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse HSP90AA1 cDNA Clone Product Information
Gene_bank_ref_id:BC046614.1
RefSeq ORF Size:2202bp
cDNA Description:Full length Clone DNA of Mus musculus heat shock protein 90, alpha (cytosolic), class A member 1 with N terminal His tag.
Gene Synonym:hsp4, 86kDa, 89kDa, Hsp89, Hsp90, Hspca, Hsp86-1, AL024080, AL024147
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

References
  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Size / Price
    Catalog: MG51995-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"