Quick Order

Rat LILRA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LILRA5cDNA Clone Product Information
Gene_bank_ref_id:NM_001076793.1
cDNA Size:888
cDNA Description:ORF Clone of Rattus norvegicus leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 DNA.
Gene Synonym:Lilrc1, Lilra5
Species:Rat
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

References
  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • Size / Price
    Catalog:RG80334-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"