After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse UBE2G1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBE2G1cDNA Clone Product Information
Gene_bank_ref_id:NM_025985.4
cDNA Size:513
cDNA Description:ORF Clone of Mus musculus ubiquitin-conjugating enzyme E2G 1 DNA.
Gene Synonym:AI256795, AU014992, AW552068, 2700059C12Rik, D130023C12Rik
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

UBE2G1 is a member of the ubiquitin-conjugating E2 family whose members perform the second step in the ubiquitination reaction. Initially identified as the main process for protein degradation, ubiquitination is believed nowadays to be crucial for a wider range of cellular processes. The outcome of the ubiquitin-conjugation reaction, and thereby the fate of the substrate, is heavily dependent on the number of ubiquitin molecules attached and how these ubiquitin molecules are inter-connected. To deal with this complexity and to allow adequate ubiquitination in time and space, a highly sophisticated conjugation machinery has been developed. In a sequential manner, ubiquitin becomes activated by an ubiquitin-activating enzyme (E1), which then transfers the ubiquitin to a group of ubiquitin-conjugating enzymes (E2s). Next, ubiquitin-loaded E2s are interacting with ubiquitin protein ligases (E3s) and ubiquitin is conjugated to substrates on recruitment by the E3. These three key enzymes are operating in a hierarchical system, wherein two E1s and 35 E2s have been found and hundreds of E3s have been identified in humans. 

References
  • Sjoerd J L van Wijk, et al. (2009) A comprehensive framework of E2-RING E3 interactions of the human ubiquitin-proteasome system. Mol Syst Biol. 5: 317.
  • Nandi D, et al. (2006) The ubiquitin-proteasome system. Journal of biosciences. 31 (1): 137-55.
  • Size / Price
    Catalog:MG51871-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"