Quick Order

Mouse TFPI2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TFPI2cDNA Clone Product Information
cDNA Size:693
cDNA Description:ORF Clone of Mus musculus tissue factor pathway inhibitor 2 DNA.
Gene Synonym:AV000670, PP5/TFPI-2, Tfpi2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Tissue factor pathway inhibitor-2 (TFPI2), a member of the Kunitz-type serine proteinase inhibitor family, is a structural homologue of tissue factor pathway inhibitor (TFPI). It is a 32 kDa matrix-associated glycoprotein consisting of a short amino-terminal region, three tandem Kunitz-type domains and a positively charged carboxy-terminal tail. TFPI2 inhibits plasmin-dependent activation of several metalloproteinases. TFPI2 is highly abundant in the full-term placenta and widely expressed in various adult human tissues, such as the liver, skeletal muscle, heart, kidney, and pancreas. The expression of TFPI2 in tumors is inversely related to an increasing degree of malignancy, which may suggest a role for TFPI2 in the maintenance of tumor stability and inhibition of the growth of neoplasms. TFPI2 inhibits the tissue factor/factor VIIa (TF/VIIa) complex and a wide variety of serine proteinases including plasmin, plasma kallikrein, factor XIa, trypsin, and chymotrypsin. TFPI2 is involved in regulating pericellular proteases implicated in a variety of physiologic and pathologic processes including cancer cell invasion, vascular inflammation, and atherosclerosis. TFPI2 has also been shown to induce apoptosis and inhibit angiogenesis, which may contribute significantly to tumor growth inhibition.

  • Peerschke EI, et al. (2004) Tissue factor pathway inhibitor-2 (TFPI-2) recognizes the complement and kininogen binding protein gC1qR/p33 (gC1qR): implications for vascular inflammation. Thromb Haemost. 92(4): 811-9.
  • Rollin J, et al. (2005) Expression and methylation status of tissue factor pathway inhibitor-2 gene in non-small-cell lung cancer. Br J Cancer. 92(4): 775-83.
  • Chand HS, et al. (2005) Structure, function and biology of tissue factor pathway inhibitor-2. Thromb Haemost. 94(6): 1122-30.
  • Sierko E, et al. (2007) The role of tissue factor pathway inhibitor-2 in cancer biology. Semin Thromb Hemost. 33(7): 653-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items