Quick Order

Text Size:AAA

Rat CD16a ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat FCGR3A cDNA Clone Product Information
Gene_bank_ref_id:NM_207603.1
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Fc fragment of IgG, low affinity IIIa, receptor with C terminal His tag.
Gene Synonym:Fcgr4, Fcgr3a
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

The Fc receptor with low affinity for IgG (FCGR3, or CD16) is encoded by 2 nearly identical genes, FCGR3A and FCGR3B, resulting in tissue-specific expression of alternative membrane-anchored isoforms. FCGR3A, it is also known as CD16a, encodes a transmembrane protein expressed on activated monocytes/macrophages, natural killer (NK) cells, and a subset of T cells.

CD16a / FCGR3A is a receptor expressed on NK cells that facilitates antibody dependent cellular cytotoxicity (ADCC) by binding to the Fc portion of various antibodies. CD16a / FCGR3A also has a broader function. CD16a / FCGR3A is directly involved in the lysis of some virus-infected cells and tumor cells by NK cells, independent of antibody binding. Cross-linking of CD16a / FCGR3A on NK cells resulted in increased intracellular Ca2+ levels and a cascade of biochemical events similar to those activated by the T cell receptor. CD16a / FCGR3A on human NK cells is a lysis receptor that mediates the direct killing of some virus infected and tumor cells, independent of antibody ligation.

References
  1. David Dornan, et al. Effect of FCGR2A and FCGR3A variants on CLL outcome. Blood. 2010 116: 4212-4222
  2. Edberg JC, et al. (2002) Genetic linkage and association of Fc gamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  3. Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  4. Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
Size / Price
Catalog: RG80017-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"