Quick Order

Text Size:AAA

Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DENV DENV-NS1 cDNA Clone Product Information
Gene_bank_ref_id:AF038403.1
RefSeq ORF Size:1056bp
cDNA Description:Full length Clone DNA of DENV-2 (strain New Guinea C) NS1 with N terminal Myc tag.
Gene Synonym:DENV-NS1
Species:DENV
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Myc tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-GFPSpark tagVG40263-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40263-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-GFPSpark tagVG40263-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40263-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Flag tagVG40263-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-His tagVG40263-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Myc tagVG40263-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-HA tagVG40263-CY$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid (Codon Optimized)VG40263-G$95
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Flag tagVG40263-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tagVG40263-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Myc tagVG40263-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-HA tagVG40263-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS1 natural ORF mammalian expression plasmidVG40263-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40263-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"