Quick Order

Mouse DPP10 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse DPP10 cDNA Clone Product Information
NCBI RefSeq:NM_199021.3
RefSeq ORF Size:2403bp
cDNA Description:Full length Clone DNA of Mus musculus dipeptidylpeptidase 10 with C terminal HA tag.
Gene Synonym:DPPX, Dprp3, 6430601K09Rik, Dpp10
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Inactive dipeptidyl peptidase 10, also known as Dipeptidyl peptidase IV-related protein 3, Dipeptidyl peptidase X, Dipeptidyl peptidase-like protein 2, DPRP-3, DPL2 and DPP10, is a single-pass type I I membrane protein which belongs to the peptidase S9B family. DPPIV subfamily. It may modulate cell surface expression and activity of the potassium channels KCND1 and KCND2. DPP10 / DPRP3 has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Genetic variations in DPP10 are associated with susceptibility to asthma (ASTHMA). The most common chronic disease affecting children and young adults. It is a complex genetic disorder with a heterogeneous phenotype, largely attributed to the interactions among many genes and between these genes and the environment. It is characterized by recurrent attacks of paroxysmal dyspnea, with weezing due to spasmodic contraction of the bronchi.

References
  • Nagase T., et al., 2000, DNA Res. 7:143-150.
  • Allen M., et al., 2003, Nat. Genet. 35:258-263.
  • Qi SY, et al.,2003, Biochem J 373 (Pt 1): 179-89. 
  • Chen T., et al., 2003, Adv. Exp. Med. Biol. 524:79-86.
  • Zagha E., et al., 2005, J. Biol. Chem. 280:18853-61.
  • Size / Price
    Catalog: MG50987-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"