After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse WIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WIF1cDNA Clone Product Information
cDNA Size:1140
cDNA Description:ORF Clone of Mus musculus Wnt inhibitory factor 1 DNA.
Gene Synonym:WIF-1, AW107799, Wif1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

WIF1, also known as WIF-1 and wnt inhibitory factor 1, is a secreted protein which binds WNT proteins and inhibits their activities. It contains a WNT inhibitory factor (WIF) domain and 5 epidermal growth factor (EGF)-like domains. WNT proteins are extracellular signaling molecules involved in the control of embryonic development. WIF1 may be involved in mesoderm segmentation and can be detected in fish, amphibia and mammals. WIF-1 is a recurrent target in human salivary gland oncogenesis. Downregulation of WIF1 takes part in the development and progression of pleomorphic adenomas. WIF1 also is a tumor suppressor, and has been found to be epigenetically silenced in various cancers, specifically in nonfunctioning pituitary tumors. WIF1 are expected to have molecular function (protein tyrosine kinase activity) and to localize in various compartments (extracellular space, extracellular region).

  • Shepelev MV, et al. (2006) WIF1: perspectives of application in oncology. Mol Gen Mikrobiol Virusol. (4): 3-7.
  • Lin YC, et al. (2006) Wnt signaling activation and WIF-1 silencing in nasopharyngeal cancer cell lines. Biochem Biophys Res Commun. 341(2):635-40.
  • Queimado L, et al. (2007) WIF1, an inhibitor of the Wnt pathway, is rearranged in salivary gland tumors. Genes Chromosomes Cancer. 46(3):215-25.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items