Quick Order

Text Size:AAA

Mouse DAN / NBL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NBL1cDNA Clone Product Information
cDNA Size:537
cDNA Description:ORF Clone of Mus musculus neuroblastoma, suppression of tumorigenicity 1 DNA.
Gene Synonym:DAN, NO3, Dana, MGC123430, D4H1S1733E, Nbl1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

The Dan (Differential screening-selected gene aberrative in neuroblastoma, also known as N03) gene was first identified as the putative rat tumor suppressor gene and encodes a protein structurally related to Cerberus and Gremlin in vertebrates. It is a founding member of the DAN family of secreted proteins, acts as an inhibitor of cell cycle progression and is closely involved in retinoic acid-induced neuroblastoma differentiation. There are at least five mammalian protein members in the evolutionarily conserved Dan family including DAN, Gremlin/DRM, Cer1 (Cerberus-related), Dante and PRDC (protein related to DAN and cereberus), and share the C-terminal cystine-knot motif. As a secreted glycoprotein, DAN is a member of a class of glycoproteins shown to be secreted inhibitors of the transforming growth factor-beta (TGF-beta) and bone morphogenic protein pathways. It binds to BMPs and preventing their interactions with signaling receptor complexes, and accordingly regulates the processes of embryonic development and tissue differentiation. DAN gene product may have an important role in regulation of the entry of cells into the S phase. In addition, DAN gene product possesses an ability to revert phenotypes of transformed rat fibroblasts and represents a candidate tumour suppressor gene for neuroblastoma.

  • Ozaki T, et al. (1995) Overexpression of DAN gene product in normal rat fibroblasts causes a retardation of the entry into the S phase. Cancer Res. 55(4): 895-900.
  • Nakamura Y, et al. (1997) A product of DAN, a novel candidate tumour suppressor gene, is secreted into culture medium and suppresses DNA synthesis. Eur J Cancer. 33(12): 1986-90.
  • Ogita J, et al. (2001) Expression of the Dan gene during chicken embryonic development. Mech Dev. 109(2): 363-5.
  • Kim AS, et al. (2003) Expression of the BMP antagonist Dan during murine forebrain development. Brain Res Dev Brain Res. 145(1): 159-62.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks