Quick Order

Text Size:AAA

Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAcDNA Clone Product Information
Gene_bank_ref_id:AB378684
cDNA Size:1410
cDNA Description:ORF Clone of Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase DNA.
Gene Synonym:Neuraminidase, NA
Species:H5N3
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Influenza A H5N3 (A/duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40236-ACG$325
Influenza A H5N3 (A/duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40236-ACR$325
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40236-CF$295
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40236-CH$295
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40236-CM$295
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40236-CY$295
Influenza A H5N3 (A/duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone)VG40236-G$95
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40236-NF$295
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40236-NH$295
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40236-NM$295
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40236-NY$295
Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40236-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

Size / Price
Catalog:VG40236-NM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"