Quick Order

Mouse SPINK4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SPINK4 cDNA Clone Product Information
Gene_bank_ref_id:NM_011463.2
RefSeq ORF Size:261bp
cDNA Description:Full length Clone DNA of Mus musculus serine peptidase inhibitor, Kazal type 4 with C terminal HA tag.
Gene Synonym:MPGC60, Spink4
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serine protease inhibitor Kazal-type 4, also known as Peptide PEC-60 homolog and SPINK4, is a secreted protein which contains one Kazal-like domain. SPINK4 is a member of the SPINK protein family. The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). SPINK1 plays an important role in protecting the pancreas against excessive trypsinogen activation. It is a potent natural inhibitor of pancreatic trypsin activity. SPINK1 mutations are associated with the development of acute and chronic pancreatitis and have been detected in all forms of chronic pancreatitis. SPINK2 functions as a trypsin/acrosin inhibitor and is synthesized mainly in the testis and seminal vesicle where its activity is engaged in fertility. The SPINK2 protein contains a typical Kazal domain composed by six cysteine residues forming three disulfide bridges. SPINK9 was identified in human skin. Its expression was strong in palmar epidermis, but not detectable or very low in non palmoplantar skin.

References
  • Schneider, A. et al., 2004,Gastroenterol Clin North Am. 33 (4): 789-806.
  • Wapenaar, MC. et al., 2007, Immunogenetics. 59 (5): 349-57.
  • Brattsand, M. et al., 2009, J Invest Dermatol. 129 (7): 1656-65.
  • Chen, T. et al., 2009, Proteins. 77 (1): 209-19.
  • Noah, TK. et al., 2010, Exp Cell Res. 316 (3): 452-65.
  • Size / Price
    Catalog: MG50953-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"