Quick Order

Text Size:AAA

Mouse REG3G Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
REG3GcDNA Clone Product Information
cDNA Size:525
cDNA Description:ORF Clone of Mus musculus regenerating islet-derived 3 gamma DNA.
Gene Synonym:AI449515, Reg3g
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids. Regenerating islet-derived 3 gamma (REG3G), also known as pancreatitis-associated protein 1B (PAP1B), is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. REG3G is expressed weakly in pancreas, strongly in intestinal tract, but not in hyperplastic islets REG3G might be a stress protein involved in the control of bacterial proliferation. It was indicated that REG3G specifically targets Gram-positive bacteria because it binds to their surface peptidoglycan layer, and serves as one of several antimicrobial peptides produced by paneth cells via stimulation of toll-like receptors (TLRs) by pathogen-associated molecular patterns (PAMPs).

  • Narushima Y, et al. (1997) Structure, chromosomal localization and expression of mouse genes encoding type III Reg, RegIII alpha, RegIII beta, RegIII gamma. Gene. 185(2): 159-68.
  • Nata K, et al. (2004) Molecular cloning, expression and chromosomal localization of a novel human REG family gene, REG III. Gene. 340(1): 161-70.
  • Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727(3): 177-87.
  • Castellarin ML, et al. (2007) The identification and sequence analysis of a new Reg3gamma and Reg2 in the Syrian golden hamster. Biochim Biophys Acta. 1769(9-10): 579-85.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items