Quick Order

Mouse NETO1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse NETO1 cDNA Clone Product Information
Gene_bank_ref_id:NM_144946.4
RefSeq ORF Size:1602bp
cDNA Description:Full length Clone DNA of Mus musculus neuropilin (NRP) and tolloid (TLL)-like 1 with C terminal HA tag.
Gene Synonym:Btcl1, AI851453, C130005O10Rik, Neto1
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Neuropilin tolloid-like 1 (NETO1), a complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing transmembrane protein, is a novel component of the NMDAR complex critical for maintaining the abundance of NR2A-containing NMDARs in the postsynaptic density. The N-methyl-D-aspartate receptor (NMDAR), a major excitatory ligand-gated ion channel in the central nervous system (CNS), is a principal mediator of synaptic plasticity. Both NETO1 and NETO2 share an identical and unique domain structure thus representing a novel subfamily of CUB- and LDLa-containing proteins. The cytoplasmic domains of NETO1 and NETO2 are not homologous to other known protein sequences but contain a conserved FXNPXY-like motif, which is essential for the internalization of clathrin coated pits during endocytosis or alternatively, may be implicated in intracellular signaling pathways. NETO1 and NETO2, have marked effects on receptor properties, increasing further the potential diversity of Kainate receptors (KARs) functional properties. NETO1 involves in the development and/or maintenance of neuronal circuitry. NETO1 regulates long-term NMDA receptor-dependent synaptic plasticity and cognition, at least in the context of spatial learning and memory.

References
  • Sthr H, et al. (2002) A novel gene encoding a putative transmembrane protein with two extracellular CUB domains and a low-density lipoprotein class A module: isolation of alternatively spliced isoforms in retina and brain. Gene. 286(2): 223-31.
  • Ng D, et al.d for synaptic plasticity and learning. PLoS Biol. 7(2): e41.
  • Perrais D, et al. (2010) Gating and permeation of kainate receptors: differences unveiled. Trends Pharmacol Sci. 31(11): 516-22.
  • Size / Price
    Catalog: MG50948-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"