Quick Order

Text Size:AAA

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 NS1 cDNA Clone Product Information
Gene_bank_ref_id:AF389122.1
RefSeq ORF Size:693bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 with N terminal Myc tag.
Gene Synonym:NS1
Species:H1N1
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Myc tag on other vectors
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-GFPSpark tagVG40011-ACG$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40011-ACR$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-GFPSpark tagVG40011-ANG$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40011-ANR$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-Flag tagVG40011-CF$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-His tagVG40011-CH$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-Myc tagVG40011-CM$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-HA tagVG40011-CY$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 natural ORF mammalian expression plasmidVG40011-M$95
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, His tagVG40011-M-H$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Flag tagVG40011-NF$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His tagVG40011-NH$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Myc tagVG40011-NM$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-HA tagVG40011-NY$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 natural ORF mammalian expression plasmidVG40011-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

The NS1 Influenza protein is created by the internal protein encoding, linear negative-sense, single stranded RNA, NS gene segment and which also codes for the nuclear export protein or NEP, formerly referred to as the NS2 protein, which mediates the export of vRNPs. The non-structural (NS1) protein is found in Influenza virus A, Influenza virus B and Influenza virus C. The non-structural (NS1) protein of the highly pathogenic avian H5N1 viruses circulating in poultry and waterfowl in Southeast Asia is currently believed to be responsible for the enhanced virulence of the strain. Non-structural (NS1) protein of influenza A viruses is a non-essential virulence factor that has multiple accessory functions during viral infection. The major role ascribed to NS1 has been its inhibition of host immune responses, especially the limitation of both interferon (IFN) production and the antiviral effects of IFN-induced proteins, such as dsRNA-dependent protein kinase R (PKR) and 2'5'-oligoadenylate synthetase (OAS)/RNase L. Non-structural (NS1) protein is a non-structural protein of the influenza A virus, which could only be expressed when cells are infected. The effect of NS1 protein on host cell is still not clear. Not only could NS1 remarkably affect metabolism, but it could also slow down cell proliferation through blocking cell cycle. Non-structural (NS1) protein may lead to the development of novel antiviral drugs, and the use of oncolytic influenza A viruses as potential anti-cancer agents.

References
  • Enami,M. et al., 1997, Nippon Rinsho. 55 (10):2605-9.
  • Bergmann,M. et al., 2000, J Virol. 74 (13):6203-6.
  • Hale,B.G. et al., 2008, J Gen Virol. 89 (Pt 10):2359-76.
  • Zhao,L. et al., 2008, Sheng Wu Gong Cheng Xue Bao. 24 (11):1912-7
  • Size / Price
    Catalog: VG40011-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"