Quick Order

Text Size:AAA

Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1701bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin with N terminal Myc tag.
Gene Synonym:Hemagglutinin, HA
Species:H1N1
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACQ63286.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged on other vectors
Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40007-ACG$345
Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40007-ACR$345
Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40007-C$395
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40007-CF$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40007-CH$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40007-CM$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40007-CY$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40007-NF$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40007-NH$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40007-NM$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40007-NY$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40007-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40007-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"