Quick Order

Text Size:AAA

Human CALM2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CALM2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001743.4
RefSeq ORF Size:450bp
cDNA Description:Full length Clone DNA of Homo sapiens calmodulin 2 (phosphorylase kinase, delta) with N terminal HA tag.
Gene Synonym:PHKD, CAMII, PHKD2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

References
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • Size / Price
    Catalog: HG16230-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"