Quick Order

Mouse CX3CL1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CX3CL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_009142.3
RefSeq ORF Size:1188bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-X3-C motif) ligand 1 with C terminal HA tag.
Gene Synonym:CX3C, Cxc3, Scyd1, ABCD-3, AB030188, AI848747, D8Bwg0439e, Cx3cl1
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is a unique chemokine that functions not only as a chemoattractant but also as an adhesion molecule and is expressed on endothelial cells activated by proinflammatory cytokines, such as interferon-gamma and tumor necrosis factor-alpha. Fractalkine/CX3CL1 is expressed in a membrane-bound form on activated endothelial cells and mediates attachment and firm adhesion of T cells, monocytes and NK cells. Fractalkine / CX3CL1 is associated with dendritic cells (DC) in epidermis and lymphoid organs. The fractalkine receptor, CX3CR1, is expressed on cytotoxic effector lymphocytes, including natural killer (NK) cells and cytotoxic T lymphocytes, which contain high levels of intracellular perforin and granzyme B, and on macrophages. Soluble fractalkine causes migration of NK cells, cytotoxic T lymphocytes, and macrophages, whereas the membrane-bound form captures and enhances the subsequent migration of these cells in response to secondary stimulation with other chemokines.

References
  • Imai T, et al. (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 91(4): 521-30.
  • Papadopoulos EJ, et al. (1999) Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 29 (8): 2551-9.
  • Umehara H, et al. (2004) Fractalkine in vascular biology: from basic research to clinical disease". Arterioscler. Thromb Vasc Biol. 24 (1): 34-40.
  • Size / Price
    Catalog: MG50917-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"