After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1707bp
cDNA Description:Full length Clone DNA of Influenza A H5N1 (A/goose/Guiyang/337/2006) HA with N terminal Myc tag.
Gene Synonym:HA1, Hemagglutinin
Species:H5N1
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABJ96698.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged on other vectors
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11690-ACG$345
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11690-ACR$345
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11690-C$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin natural ORF mammalian expression plasmidVG11690-C-N$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11690-CF$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11690-CH$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11690-CM$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11690-CY$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11690-NF$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11690-NH$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11690-NM$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11690-NY$315
Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11690-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11690-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"