Quick Order

HIV-1 (group M, CRF07_BC) GP120 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIV GP120 cDNA Clone Product Information
Gene_bank_ref_id:JQ905580.1
RefSeq ORF Size:1521bp
cDNA Description:Full length Clone DNA of HIV-1 GP120 with N terminal Myc tag.
Gene Synonym:gp120
Species:HIV
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer of the virus, which is an essential component in the multi-tiered viral entry process. It presents itself as viral membrane spikes consisting of 3 molecules of gp120 linked together and anchored to the membrane by gp41 protein. Gp120 is essential for viral infection as it facilitates HIV entry into the host cell and this is its best-known and most researched role in HIV infection. However, it is becoming increasingly evident that gp120 might also be facilitating viral persistence and continuing HIV infection by influencing the T cell immune response to the virus. The surface protein gp120 attaches the virus to the host lymphoid cell by binding to the primary receptor CD4. Gp120 binding to its receptor CD4 and co-receptor, CXCR4 or CCR5 is required for fusion of viral and cellular membranes. Several mechanisms might be involved in this process of which gp120 binding to the CD4 receptor of T cells is the best known and most important interaction as it facilitates viral entry into the CD4+ cells and their depletion, a hallmark of the HIV infection. Gp120 is shed from the viral membrane and accumulates in lymphoid tissues in significant amounts. Despite the overall genetic heterogeneity of the gp120 glycoprotein, the conserved CD4 binding site provides an attractive antiviral target. Interaction between gp120 and ITGA4/ITGB7 would allow the virus to enter GALT early in the infection, infecting and killing most of GALT's resting CD4+ T-cells. This T-cell depletion is believed to be the major insult to the host immune system leading to AIDS.

References
  • Kadow J, et al. (2006) Small-molecule HIV-1 gp120 inhibitors to prevent HIV-1 entry: an emerging opportunity for drug development. Curr Opin Investig Drugs. 7(8): 721-6.
  • Stevceva L, et al. (2007) Immune responses to HIV Gp120 that facilitate viral escape. Curr HIV Res. 5(1): 47-54.
  • Yoon V, et al. (2010) The GP120 molecule of HIV-1 and its interaction with T cells. Curr Med Chem. 17(8): 741-9.
  • Size / Price
    Catalog: VG11233-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"