After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human cytomegalovirus (HCMV) gB Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GBcDNA Clone Product Information
Gene_bank_ref_id:AY315197.2
cDNA Size:2724
cDNA Description:ORF Clone of Homo cytomegalovirus gB DNA.
Gene Synonym:gB
Species:CMV
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human cytomegalovirus (HCMV) gB Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

Human cytomegalovirus (CMV) (human herpesvirus 5) glycoprotein B, also referred as CMV gB or gB, which belongs to the herpesviridae glycoprotein B family. It is a 907-amino acid glycoprotein encoded by the ORF of UL55. Cytomegalovirus Glycoprotein B protein is the most abundant component of the envelope, a target of neutralizing antibodies with at least two defined neutralizing epitopes and an essential replication component. Cytomegalovirus Glycoprotein B protein plays important roles in HCMV entry, cell-cell spread of internal virions, and fusion of infected cells. In addition, Cytomegalovirus Glycoprotein B protein is one envelope protein capable of heparin binding. It forms a physical association with host cell annexin II independent of the presence of calcium.

References
  • Lopper M,et al. (2002). Disulfide bond configuration of human cytomegalovirus glycoprotein B. J Virol. 76(12): 6073-82.
  • Isaacson MK, et al. (2009) Human cytomegalovirus glycoprotein B is required for virus entry and cell-to-cell spread but not for virion attachment, assembly, or egress. J Virol. 83(8): 3891-903.
  •  

     
    Size / Price
    Catalog:VG10202-NM
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"