Quick Order

Mouse CDH16 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDH16cDNA Clone Product Information
cDNA Size:2433
cDNA Description:ORF Clone of Mus musculus cadherin 16 DNA.
Gene Synonym:Cdh16
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

KSP-Cadherin/Cadherin-16 is a member of the cadherin superfamily, calcium-dependent, membrane-associated glycoproteins. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. KSP-Cadherin/Cadherin-16 can be detected at later stages of tubulogenesis during human renal development and in the distal tubules of adult kidneys, no expression was found by immunohistochemistry or Western blot analysis in RCC tumour tissues and several RCC cell lines. However, despite the lack of protein expression, mRNA synthesis of KSP-Cadherin/Cadherin-16 could be detected by reverse transcriptase-polymerase chain reaction analysis in all RCC tissues and most of the RCC cell lines studied, although at a reduced level. The loss of KSP-Cadherin/Cadherin-16 protein was only observed in the malignant part of the tumour kidneys, whereas in the normal part of the affected kidneys KSP-Cadherin/Cadherin-16 expression was clearly detected. These results indicate a downregulation of Ksp-cadherin in RCC and suggest a role for this cell adhesion molecule in tumour suppression.

  • Thomson RB, et al. (1999) Immunolocalization of Ksp-cadherin in the adult and developing rabbit kidney. Am J Physiol. 277 (1): 146-56.
  • Thedieck C, et al. (2005) Expression of Ksp-cadherin during kidney development and in renal cell carcinoma. Br J Cancer. 92(11): 2010-7.
  • Bai Y, et al. (2002) Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta. Am J Physiol Renal Physiol. 283(4): 839-51.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks